Biotin 488
WebAnti-Rabbit Alexa Fluor® 488 secondary antibody validated for ICC/IF, IHC-Fr, Flow Cyt. Ideal for fluorescent cell and tissue imaging. Cited in 1396 publications. ... Fluor® 647 Alexa Fluor® 680 Alexa Fluor® 680 Alexa Fluor® 750 Alexa Fluor® 790 Alkaline Phosphatase APC beta-galactosidase Biotin Cy2 ... WebThe City of Fawn Creek is located in the State of Kansas. Find directions to Fawn Creek, browse local businesses, landmarks, get current traffic estimates, road conditions, and …
Biotin 488
Did you know?
http://www.nanocs.net/Alexa-fluor488-PEG-biotin-3k.htm http://www.rx-8.com/chanpinzhongxin/202479.html
WebLipidSpot™ 488 has excitation around 430 nm, and can be excited equally well at 405 nm or 488 nm. In cells, it stains lipid droplets with bright green fluorescence detectable in the FITC channel. LipidSpot™ 488 has been … WebATP7B Antibodies. Antibodies that detect ATP7B can be used in several scientific applications, including Western Blot, Immunocytochemistry, Immunohistochemistry, Immunoprecipitation and ELISA. These antibodies target ATP7B in Human, Rat and Mouse samples. Our ATP7B polyclonal and monoclonal antibodies are developed in Rabbit and …
WebDec 21, 2011 · HAuCl 4 ·3H 2 O, 3-mercaptopropionic acid, L-Ascorbic Acid, PBS, Atto 488, Atto 520, and Atto 550 were obtained from Sigma-Aldrich. Streptavidin (SA) and D-biotin (B). 1-Ethyl-3-(3-dimethlamino propyl) carbodiimide hydrochloride (EDC) was obtained from Sigma-Aldrich and used bioconjugation process. WebNEUROBIOTIN® [488 Tracer] Summary. Description. NEUROBIOTIN 488 Tracer is a tri-functional molecule designed for neuronal tracing and cell filling. Features. Bright green fluorophore, similar in fluorescence to fluorescein, Cy2 or Alexa Fluor® 488. Biotin label with a biotinidase-resistant linkage. Fixable primary amine.
WebBiotin. Biotin is a small 244-dalton hapten molecule. Its high binding affinity for streptavidin is commonly exploited to detect and monitor biological targets of interest. Biotin exhibits two characteristics that make it ideal for bioconjugate development. First, biotin is …
WebThe Biotin Antibody [DyLight 488] from Novus Biologicals is a rabbit polyclonal antibody to Biotin. This antibody reacts with non-species specific. The Biotin Antibody [DyLight 488] … hill-rom companyWebAPDye™ 488 Biotin can be used for detecting and quantifying biotin binding sites of avidin, streptavidin or neutravidin. This reagent overcomes major shortcomings of commonly used Biotin-4-fluorescein – poor … smart buy kitchens naples flWebFeb 21, 2024 · The short fluorescent ssDNA substrate used in FCS experiments was prepared with synthetic oligonucleotides (Eurogentec) labeled either with Biotin or Alexa-488 in 5’ in order to generate a Biotin-labeled DNA strand and a fluorescently-labeled DNA strand (Sequence : Biotin-5’GCTTGCATGCCTGCAGGTCG3’; Alexa488 … hill-rom ic beds spo2rt2 bed system p1900WebAtto 488-Biotin. BioReagent, suitable for fluorescence, ≥90.0% (HPLC) View Price and Availability. Sigma-Aldrich. 28616. ... Biotin (5-fluorescein) conjugate is a reagent that may be used in situations similar to … hill-rom procedural stretcherWebMay 16, 2024 · HABA is displaced when biotin binds to the Alexa Fluor 488 dye-labeled avidin, resulting in decreased FRET efficiency. This mechanism results in an increase in fluorescence intensity directly related to the amount of biotin present in the sample. The assay is able to detect as little as 4 pmol biotin in a 0.1 mL volume within 15 min of … smart buy logoWebAlexa Fluor® 488 (AF488, Alexa 488) is a green-emitting synthetic fluorophore that can be excited by the 488 nm blue laser and captured with a 530/30 nm bandpass filter. AF488 … smart buy motors calumet city ilWebThe conjugates of streptavidin are commonly used together with a biotin conjugate for specific detection of a variety of proteins, protein motifs, nucleic acids, and other biomolecules in western blots, flow cytometry, imaging and microscopy, and microplate assays. XFD488-streptavidin conjugate is equivalent to Alexa Fluor® 488 streptavidin ... smart buy mortgage illinois